Fam114a1 gene
WebExpression of FAM114A1 (Noxp20) in cancer tissue. The cancer tissue page shows antibody staining of the protein in 20 different cancers. ... FAM114A1: Gene description i. Family with sequence similarity 114 member A1: Predicted location i … WebMar 21, 2024 · GeneCards Summary for FAM114A1 Gene. FAM114A1 (Family With Sequence Similarity 114 Member A1) is a Protein Coding gene. Diseases associated … ACTA2 (Actin Alpha 2, Smooth Muscle) is a Protein Coding gene. Diseases …
Fam114a1 gene
Did you know?
WebUse Bio-Rad's PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed. FAM114A1 - …
WebFAM114A1 has 2,879 functional associations with biological entities spanning 8 categories (molecular profile, organism, chemical, functional term, phrase or reference, disease, … Webfam114a1 ID ZDB-GENE-070410-52 Name family with sequence similarity 114 member A1 Symbol fam114a1 Nomenclature History Previous Names. zgc:162266; Type protein_coding_gene Location Chr: 1 Mapping Details/Browsers Description Orthologous to human FAM114A1 (family with sequence similarity 114 member A1). ...
WebNov 29, 2024 · Fam114A1 is a gene closely related to the development of nerve cells, melanocytes, and nerve cells that originate from the neural crest of the embryonic ectoderm. Recent studies showed that Fam114A1 has a role in the occurrence of ankylosing myelitis spondylitis and autoimmune enteritis; still, its cellular function remains poorly understood. WebSep 1, 2024 · Spermatogenesis is a highly complex and dynamic mechanism controlled by an elaborative system that includes precise gene expression in a developmental stage - …
WebSep 1, 2024 · Fam114a2, also known as C5orf3 and its paralog Fam114a1, belong to nervous overexpress protein family and have been implicated in neuronal cell …
WebUpdates to this gene will be send to {{ username }} {{geneWatchAttr}} ... Orthologous to human FAM114A1 (family with sequence similarity 114 member A1); INTERACTS WITH … scratch support emailWebFAM114A1. gene product. Noxp20. The protein encoded by this gene belongs to the FAM114 family and may play a role in neuronal cell development. Alternative splicing … scratch surpriseWebby Gene › by Protein › FAM114A1 Antibodies; FAM114A1 Antibodies . Antibodies that detect FAM114A1 can be used in several scientific applications, including Western Blot, Immunohistochemistry, Immunocytochemistry and Immunoprecipitation. These antibodies target FAM114A1 in Human, Mouse and Rat samples. Our FAM114A1 polyclonal … scratch survivalWebGene interactions and pathways from curated databases and text-mining. PPAT: top 25 interacting genes (chr4:57259528-57301802) Mouse over or click genes or lines for details. Dashed lines indicate interactions without text mining support. Click any gene to make it the new center. ... FAM114A1 FPGS HSPA4 ... scratch survivorWebContact UAB Privacy Terms of Use © 2024 The University of Alabama at Birmingham; UAB is an Equal Opportunity/Affirmative Action Employer committed to fostering ... scratch surgeryWebMutation details: This allele from project Fam114a1-7878J-M7854 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCAAGCAACCACATCTCCC, AGATGTGGTTGCTTGGTGGT, TTTGACATAGCGTACATTGA and ATGGAGTTTAACGTTTGCTC, which resulted in a … scratch surfaceWebSep 1, 2024 · Spermatogenesis is a highly complex and dynamic mechanism controlled by an elaborative system that includes precise gene expression in a developmental stage - dependent manner [1]. ... Fam114a2, also known as C5orf3 and its paralog Fam114a1, belong to nervous overexpress protein family and have been implicated in neuronal cell … scratch surprise book